Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11627A10
Clone ID IST11627A10
Vector VICTR76
Project tigm

Sequence tag IST11627A10BBF1
Sequence
GTTTGCCTCAAACACGGCCCCACTAAATTGCCCANACTANCTTTGAACTTGCTCTGTANCCCAGGCAGGTCTGAAAAGTT
TGATCCTTCTGTCTNANCCTCCTGGATGTTGGAATTATAAGCTTTTGACATTGTGCCTAGTTCTAGCTTGTCCTTTTAGC
ACATTTGCCAATCTTGCCAGTTGACAGCTGTTGGCCATGGGTGGCACAGGACANGATTGTTATGGTANGANACAGTGTAT
TCTTAGAACANNNCACAAAANTANTACTNNGAAACAAGAAGAATTTTCTTTANGTCANCGTGCTGGGAAGANGGCANACT
TGGGTGTTCTTACCTTCANCTTGTATAGACNCNNGAGCNCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11627A10HMF1
Sequence
GTTTGCCTCAAACACGGCCCCACTAAATTGCCCAGACTAGCTTTGAACTTGCTCTGTAGCCCAGGCAGGTCTGAAAAGTT
TGATCCTTCTGTCTCAGCCTCCTGGATGTTGGAATTATAAGCTTTTGACATTGTGCCTAGTTCTAGCTTGTCCTTTTAGC
ACATTTGCCAATCTTGCCAGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34306191..34306372 182
NO GENE  


Sequence tag IST11627A10HMR1
Sequence
AACAANAAAAGAGGAAAGGGAAAGAAAAACCTCCACACTGTTTCCATTTGTACTCTCTGCATTCCAACCTCTCATCACTG
GGCATGGGTCTGGAGGCACCTGACAAATCACACCACCGTCCAGTTCATAGTCCTTCGGGGACTGCTTTCAGGAAATGGAG
GAGTGTACATGACTGCTGTTCGTTACTGAAGCTTTTGTCANAGCTAGACGCATGAANATGTGTGCAAGAAGATAATGACG
GGAAAAGCCTGCCTTANATTAAGGAATTGTAACCNTACCACCCTTTGTTGGTCANATAATATANATAAGGCANATTCTTA
ACTCATCTAATCTTCTTTATCANCCNCCAAAATANGTGCTATTANGATTCTTTTTTTTTAAGATTTATNATTN
Sequence Type genomic DNA
Unitrap ID UNI13451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34306370..34306761 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037636 (Slc25a43) NM_001085497 solute carrier family 25, member 43 Gene [Source:MGI (curated);Acc:Slc25a43-001]

 
Come back to gene ENSMUSG00000037636


For any suggestions or comments, please send an email to unitrap@crg.es