Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12448F8
Clone ID IST12448F8
Vector VICTR76
Project tigm

Sequence tag IST12448F8BBF1
Sequence
GTGCATACCTGTAATCTTAGCAAAGGCAGAGGCAAGCGGATCTCTGAGTTCATGGCCAGCCTG
Sequence Type genomic DNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3352560..3352622 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]


Sequence tag IST12448F8HMF1
Sequence
GTGCATACCTGTAATCTTAGCAAAGGCAGAGGCAAGCGGATCTCTGAGTTCAT
Sequence Type genomic DNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3352560..3352612 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es