Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10190D12
Clone ID IST10190D12
Vector VICTR76
Project tigm

Sequence tag IST10190D12HMF1
Sequence
TTATCATACACTAATTATGCCTGCTTAAAGATGCAACAGATTTTTTCCCTTCCAGTTCTCAACAATAACAACTATAACAA
TAACAACAACAAACCATTTATTTTCCTTAATAAGATTAAAGTGTGAGTACTAGCCTAAGGCANAAATGTTGCAAAAGTTT
TTTCTTTTTTGAAAAATGGTTANATTTGCTTTTTGTGTGGTAATTTANGCCAAACTTGTACTTATATTTTACTCATGAAA
ATATTGAANGGGATGGGTATGGAGGGGAGTGTGCTGATGTTGAAGATGAAGGGGTGGGAGGCAGGTAGGCCAGGCTGATT
GTCTATCAAACCCTGACATGTACAGTATCAGATAAAGATTAGATCCNANTATTAGCGTTCTCTCTGTCTGTCTGTCTGTC
TGTCTGTCTATCTACTTATTTATTTACTCATTTAGTTNANCTTTANATCAGANTGGTCCTAATCTCANANACCTANTTGC
CTTTGCATCCCTAAAAATGTANANCTGGATCTGTGGNTT
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82318041..82318556 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]


Sequence tag IST10190D12BBF1
Sequence
TTATCATACACTAATTATGCCTGCTTAAAGATGCAACAGATTTTTTCCCTTCCNGTTCTCAACAATAACAACTATAACAA
TAACAACAACAAACCATTTATTTTCCTTAATAAGATTAAAGTGTGAGTACTAGCCTAAGGCANAAATGTTGCAAAAGTTT
TTTCTTTTTTGAAAAATGGTTAGATTTGCTTTTTGTGTGGTAATTTANGCCAAACTTGTACTTATATTTTACTCATGAAA
ATATTGAAAGGGATGGGTATGGAGGGGAGTGTGCTGATGTTGAAGATGAAGGGGTGGGAGGCAGGTAGGCNAGGCTGATT
GTCTATCAAACCCTGNCATGTACAGTATCNGATAAAGATTANNTCCGAATATTAGCGTTCTCTCTGTCTGTCTGTCTGTC
TGTCTGTCTATCTACTTATTTATTTACTCNTTTAGTTTANCTTTANATCAGATTGGTCCTAATCTCANANACCTANTTGC
CTTTGCATCCCTAAAAATGTANATCTGT
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82318041..82318547 477
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es