Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14808A7
Clone ID IST14808A7
Vector VICTR76
Project tigm

Sequence tag IST14808A7BBF1
Sequence
GCTCCCAGAAAACAGTAAGCAAAGAGACCACAGCACAGTGGGTCTTAGGAGCAAGCGACAGAGGTAGGAAGATCAATAGT
CTGAGAGTAGCCTGCTTTATGAAGTGAAATCAACTCAAAAAGGAAACCAGCTAGCATTAACGAGTACCTGGCTTCCCCTA
ACAACGCCTGCGTGTTTATGTATGTACTTCGTACGCTGCCTCCGCTCAGCACATACCCTGCTCTGGAATAGGCCGGTACT
GGTCTGTGTCCCATTCACTCCTAGGCTTCTCAGAGTCTACAGAGAGCTGGGAATCCTGGGGAATGCAGACTACAAATGAG
ACTACAAAGGGCCTGGCAAAGGAGCAAGATGACGATGGTACGGCAGACCCCCTANCAATGACTAAATGAGCCCAGAGACC
ATTTCTGTGTACCACAGTGTACAATAAACTTGCCAATGAGCGAANGCAGACCCGAGAAACAAAATCCAAACCTCAGCAGT
TCAGANCAGTGATTCTCAACCNGGGTGAGTTTACCCCCTGCTTCTCCCNGGGNTAACNGGCAAATGTCNNGAGACATTTT
TAATTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46401999..46402565 549
 
EST/CDNA Est Name
  BI684006.1 - BQ884502.1 - BU522574.1 - BF234716.1 - BG923482.1 - CA879998.1 - CK344403.1 - BB664103.1 - BB643259.1 - CN675287.1 - BU054746.1 - CF893102.1 - BE916187.1 - CF916062.1 - CN715874.1 - BY285796.1 - CN723930.1 - AW106046.1 - BE380665.1 - BY732195


Sequence tag IST14808A7HMF1
Sequence
GCTCCCAGAAAACAGTAAGCAAAGAGACCACAGCACAGTGGGTCTTAGGAGCAAGCGACAGAGGTAGGAAGATCAATAGT
CTGAGAGTAGCCTGCTTTATGAAGTGAAATCAACTCAAAAAGGAAACCAGCTAGCATTAACGAGTACCTGGCTTCCCCTA
ACAACGCCTGCGTGTTTATGTATGTACTTCGTACGCTGCCTCCGCTCAGCACATACCCTGCTCTGGAATAGGCCGGTACT
GGTCTGTGTCCCATTCACTCCTAGGCTTCTCAGAGTCTACAGAGAGCTGGGAATCCTGGGGAATGCAGACTACAAATGAG
ACTACAAAGGGCCTGGCAAAGGAGCAAGATGACGATGGTACGGCAGACCCCCTAGCAATGACTAAATGAGCCCAGAGACN
ATTTCTGTGTACCACAGTGTACAATAAACTTGCCAATGAGCGAANGCAGACCCGANAAACAAAATCCAAACCTCAGCAGT
TCANANCAGTGATTCTNNNCNNGTGANTTTACCCCCNGCTTCTCCAGGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46401999..46402535 501
 
EST/CDNA Est Name
  BI684006.1 - BQ884502.1 - BU522574.1 - BF234716.1 - BG923482.1 - CA879998.1 - CK344403.1 - BB664103.1 - BB643259.1 - CN675287.1 - BU054746.1 - CF893102.1 - BE916187.1 - CF916062.1 - CN715874.1 - BY285796.1 - CN723930.1 - AW106046.1 - BE380665.1 - BY732195


Sequence tag IST14808A7HMR1
Sequence
GGAGCCTTCAGGTCCCAGNCTGGACAGGCAGGCAGCTGACACCGGGTTTCCACTTTCTCCCCTTCTCTGGTTTCAGGAGC
TCTTGGCTAGAGGAAGTAGAGGGGCCGTGGGATGTGGAGAGCCGAAGGCTGATTCCAGGAGAGCAGAACAGAGAGCTGCC
AGCGAACAGACGGTATGTCCCGATGAGGCCTGCATTCTATACTTTGTTCTCTTCTGGGAGGCTGGTANGTGANCANCCNT
ATAGGTGCTCTCTTCCNNTGGGAGCCNNCACAGAAAGGAGGTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI7106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46401718..46402003 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

 
Come back to gene ENSMUSG00000012296


For any suggestions or comments, please send an email to unitrap@crg.es