Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11710F7
Clone ID IST11710F7
Vector VICTR76
Project tigm

Sequence tag IST11710F7HMF1
Sequence
CCGAGAGATTAGGGTAGGGTGGTTTACTGGTTATCTCTGCCTGTACACTTANCATCTCTGAAAGACCATAAAAGAACCAT
GCGCACCCATTATGCANATCGTAAGCTGAAGTTCACTAACAAAAACCCAGGTGTGTATAAGTACGCCCCACATTGAANAT
CTGATACTGGAAACCGGANCTTTCTTTCCACCTCACCCAATGCCNATCTCCTNTTGNCCTNNNTTTTNATGTGAANAAAA
TGGAATGGGCTCCACGCTTCCNNTTTGGACGCTGGATAATGCCTATTTCTNACAACTGTTTTCCNNGGCACCGCTCCCTC
CCGGGCCGCATCCNTNANNNGTTCTCATAGGATTNNNCGNAAGGGACGGTCCCGGANGGGCAATGCCTGGCTTCTGTNNT
CTTGANCCGGGAGANCTTATTTAGCCTTANCTCTGANGCANCTGGNGAGCTGGGCTGACTCNNGACNGTCNCGGGTGCTT
GCTGTANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11710F7BBF1
Sequence
CCGAGAGATTAGGGTAGGGTGGTTTACTGGTTATCTCTGCCTGTACACTTANCATCTCTGAAAGACCATANAAGAACCAT
GCGCACCCATTATGCAGATCGTAAGCTGAAGTTCACTAACAAAAACCCAGGTGTGTATAAGTACGCCCCACATTGAAGAT
CTGT
Sequence Type genomic DNA
Unitrap ID UNI29581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45870269..45870431 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011256 (Adam19) NM_009616 a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI (curated);Acc:Adam19-001]

 
Come back to gene ENSMUSG00000011256


For any suggestions or comments, please send an email to unitrap@crg.es