Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12064C1
Clone ID IST12064C1
Vector VICTR76
Project tigm

Sequence tag IST12064C1BBF1
Sequence
GCTCGACATTTTGGCCNNGGTGAATTGCTGGTGCGGACCCTGTTTGTTTCTTATCAAAGGCCTTCCAGTGGTGGCTTAAC
AAGGACCATGCAGCCCCTGCGTGCCTCTCCTCCTGAATCCAACTATTATCCATCTGGGTCAAAGGCCTATCTGGTAGGCC
TGTGTTTTGACTCTGGCTTGGGGAGAATAGTGGAAGGACTANCCAAGTTTTAAGTACTTTGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32007

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58159239..58159467 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]

 
Come back to gene ENSMUSG00000032334


For any suggestions or comments, please send an email to unitrap@crg.es