Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14931E12
Clone ID IST14931E12
Vector VICTR76
Project tigm

Sequence tag IST14931E12BBF1
Sequence
ACCTAAAGTTCTTTGGCAGTGTGACAGGAAGCCAGCTGACAGTGGCACTGAAGGCCCGAGCAAAGGTGANAGGACAGAAA
ANAACAGACCGCCGGGAGCACCATGACAGCACGACCCAAGCAGGGCAAATGGTAGCCTCGGAGGAAAGGATCTGCAGGGG
ATGTGAATCAAACAGGGACTTGGGGGTCCCCTCTTGTCTTGTTAGCTTCTANGCCAGCCCTGGGACCGAGGCTCCANAAG
AAAGGCAAAGGCNNANAGGTTCACAGCCCANCTCAAANTACTCNACTGTGGAGATCANAAACTCTANCGATGGGCTCCAA
ACCGCCTGCCCTTGGTCAAGCTGTATGTGGGAAAATTGAANCTCANGGAGACCAAATCTGCACGGTCACCTAACCNNNAA
GGCCTGTGANGGCTGGTGCNNCNGGCTCCAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14931E12HMR1
Sequence
TGAATGTGGAGTTTGCTTGCTCCCTTGGAGTANAATTTTTATTCCTCAAGCCCAAACCCTTTGGAGTAGATGGCCGGCAT
GCAGTTTTGCACCCACGTTATCTTCTTCCCTGTCNCN
Sequence Type genomic DNA
Unitrap ID UNI20803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5106139..5106252 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024870 (Rab1b) NM_029576 RAB1B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1923558]

 
Come back to gene ENSMUSG00000024870


For any suggestions or comments, please send an email to unitrap@crg.es