Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14274F5
Clone ID IST14274F5
Vector VICTR74
Project tigm

Sequence tag IST14274F5BBF1
Sequence
GCCTTAAGANAAAATAATACAGCAAAAGCTGGTTACTTGGTAATAGGCTATCAATTAGGGAAGGCGGAAGANCCCGANAT
TGCTGGACAGCAATGTGAACATAGCCNTGGTGGCTCTTGCCTTANAAGCCTGGCACTTATGACACTGACGCAATAGTACT
AACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26653076..26653239 154
NO GENE  


Sequence tag IST14274F5HMR1
Sequence
ANGCATTTTATTTTGTGTATTTTCNTAATGCAAAATAAGGGACTTTTTTATTTTTTTAAAGGCAAGGTCTCANATCTTGT
TGCATAGTCTGAATGGCCTGGAAATTGCTCTGTATACCAGGTTTAGTTAATCTGCCTGCCTCTGTCTCTGGATGCC
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26653238..26653390 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es