Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14131E9
Clone ID IST14131E9
Vector VICTR74
Project tigm

Sequence tag IST14131E9BBF1
Sequence
GTAACCNAGACTTGTCTCTGCACATTGTTCAGGGGTCCCTAGAGACATGGCTGCTCTAGTAGAGAACCATGAACTCAAAA
CATTAACCAGTAAGAACTCATGGTAATAATGGAACCAGCTCTGTGCACTGTTTTGAAGTCTCCGCACAGGCAGAGAGGGG
AGTCTCTCGCCTGCATGTGATAACGTTCCCACAGGAGCAAAGGACTTGAAAGANGAAATACCCCCTGCATCAGTTACTTA
ATCTATGGCTGTGATAGACCACTATGACCAAAGCTACTTAGAGAANGAAGGGTTTATTGGGGCTGCTGGTTCCTCCAGCT
GGTAAGAGTCCCTCATCATTACTATAGAGGAGCAGCCNGCANGCNTAGCANCNNGANGAACAAACTGANAGCTCACATCT
TANNTCACAAGCNANANCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57276688..57277106 387
 
EST/CDNA Est Name
  BI221804.1 - CK388377.1 - CB575176.1 - BU694424.1 - BU698154.1 - CK332200.1 - CA578903.1 - AW987994.1 - AW519786.1 - AI006556.1 - DT929710.1 - AA798287.1 - CA578716.1 - BE653782.1 - BE632316.1 - BE334530.1 - CA460028.1 - BG085430.2 - BB618486.1 - CD298559


Sequence tag IST14131E9HMF1
Sequence
NTAACNNANACTTGTCTCTGCACATTGTTCAGGGGTCCCTANANACATGGCTGCTCTANTANAGAACCATGAACTCNAAA
CATTAACCNNTAAGAACTCATGGTAATAATGGAACCNNCTCTGTGCACTGTTTTGAAGTCTCCNCACAGGCNGAGAGGGG
AGTCTCTCNCCTGCATGTGATAACNTTCCCACAGGAGCAAAGGACTTGAAAGANGAAATACCCCCTGCATCNNTTACTTA
ATCNATGGCTGTGATANANCNCTATNANCNAANCTACNTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14131E9HMR1
Sequence
TTACNANTANNNNNNNGGGATGGAGGCCATGGGATTGTCTCACACTATGACTGTGAAGTATATCTACATAGGTTTCTTTG
TTCTCTGCCATAGCCTGGACCAGACTAGGGCCCTAAAGTANAGGCATCACTGAGAATTCTGTTTCCATTGCCCTCTCCCT
CCCCCATCTTTCCAGAGACCCNNATTCCANATTCAGCAGAGAAAAGGAAACCANCCTCGTGAACTGGTTTCAGGAAGGAA
TCTCTATAAATGCTAGACACAATGCANACAGCTTATGCAATCNTGTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI10480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57276402..57276675 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es