Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710H8
Clone ID IST14710H8
Vector VICTR76
Project tigm

Sequence tag IST14710H8HMR1
Sequence
NNNAAACAACCNNGTGAAAAACTCACTTGGGAATTTTTGGAAGTGGCTCAAGTGGGATAAATGTGTCNAATTTTTTCTCG
TAAGGTCCCCTGGGGGGAAAACAAAACAGTAAAAACAATCATAAAATTGCTATGGCTTCTAAAAGCACAGAGAGCAACAC
ATGATCACGTCCAGAATGTGTCCTATTTTCTGGTATCAGTTCTCAAACATGAGCTTCAAGACTACAGAGAACAATGTTTC
ATCAAAATCATTGACTCCCACCANACGGGTTTTCTANATATTTTCAATATAATACAACCACTGTTTGTTCTTTCAGTTGA
TGACTCTTCTCTCTAATCNTATTGTTCTAAGTTTGCCCCCACCTTTAAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45589604..45589972 357
NO GENE  


Sequence tag IST14710H8BBF1
Sequence
NNNNNANANNNNNNNAANCNCTNNTCTNCTTTCNNTTTNANTTANATAANTGAANTCNTANNTTANNNNCTANGTGGGAA
AAAATANAACAANCNNTNAANATAAAACTAATTTATAANACNCNAACCACACTATTGGCTATTATCACATATTCACACGT
GTTTTGNACTCTCTTTCNNAGCNNNNCTAACTGANTACANNNGAAGGACTTNNANAGCANGCCNNNCCCCCCTTNANTTN
NNCCTTCCTTCATGANTNACNTGTTACNCTTAATGCTTTCTTTAAAAATTTACATTGTAAGGCTTTTAGTCTAATTTCCT
ATCAGTATTCCAGTATATCCGGTTTTNATGTATATGCAATCCCCGCTTGTATTCCTGACAAATACGCTACTCCCCCTGAA
CACAGACATGANGGAGGTGAGACTATTAAATATTTANAAGAGCCNNNANNTCCNNGGATGGCTGATGGTCTGTGTCANTC
NGGCTGANCAGANGGGNGTGCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14710H8HMF2
Sequence
TTGATCCCTCTGTGGAAATGAAACACTTTTCTCCCATGGAGGGGCCTTCAGTCAGTGAAACCATGGGGACCTTTTGTGTC
CCGCAACAGGGTCAGTGCAGAATATATATGGTGGACAGTTGGAGAGACCCATGGAAGTCAAAGGGTCTGTGGCATCTGGA
Sequence Type genomic DNA
Unitrap ID UNI14634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45589445..45589602 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es