Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10322H8
Clone ID IST10322H8
Vector VICTR76
Project tigm

Sequence tag IST10322H8HMF1
Sequence
CCGCCCAGGCTGCTGCCTCAGCGGCTCTGTGCTTCTGCTCGTCCCANAANCTGTCCGGTTCTCTGGCGCACCCTCTAACC
TGTTCAGACTAATTTCCTAAGTTCTGCTGAGTCCCGGAACCCAGATGGCGACCACTGCTGCTGAGGCTGAGGCCGTCTCC
CGAGCCAGGCGGACACCTGTCCTCTGGTCCGGATGTTGGCCGGTTGTCTGCGGCCCGCCCAGGCTGCTGCCTCAGCGGCT
CTGTGCTTCTGCTCGTCCCANNANCTGTCCGGTTCTCTGGCGCACCCTCTAACCTGTTCAGACTAATTTCCTAGGTCCCG
CGGAGTCCCGGAACCNAGATGGCGACCGCTGCTGCTGNNGCTGANAACGCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 93614351..93614723 349
NO GENE  


Sequence tag IST10322H8HMR1
Sequence
NANNGGCNACCATCCGGACNAGAGGACAGGTGTCCGCCTGGCTCGGGAGACGGCCTCAGCCTCAGCAGCAGCGGTCACCA
TCTTGGTTCCAGGACTCCCTGGAACTTAGGATTTTAGTCTGCACAGGTGAGAGTCTGCACCACAGAAACGGACAGCTTCT
GGGAACTGCCAAAACAACACAGCTTCTGANAAAGGCCCTGTTTTGGGTCTTCTTCTTCNACNNNGAGGAGGTCCAAAAAC
AAGATATCTGCGCACCTTCCCTGTAANANAGCTTGCCAGCAGANAGTGCTNTN
Sequence Type genomic DNA
Unitrap ID UNI36191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 93614052..93614337 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055421 (Pcdh9) NM_001081377 protocadherin 9 Gene [Source:MGI Symbol;Acc:MGI:1306801]

 
Come back to gene ENSMUSG00000055421


For any suggestions or comments, please send an email to unitrap@crg.es