Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14919D2
Clone ID IST14919D2
Vector VICTR76
Project tigm

Sequence tag IST14919D2HMF1
Sequence
ACTGCAGAATCTCTCCCTCCCACACCACAGGGCCCAAGGCAGTCAGCACCCACCAGTCCAGACACCCTCCTCACTTCTGT
CTCCCCGCAACACCCAAGGCATGTCAAAATGACCCCGGCTTGGCTTTTCCCCCNCAAAAGGGGAAAACATGCTANCCTTA
GGATGTANCATACCTTATTTATCAGACAGCTGAACCCTCAACCTGTTATGACACAGGACAGGCATGAATGAGGCAGTTTG
GTAAAACTTTTTTCTGCCTCCCCCTGACCCCCAAAGTCTCTCCCCTCTGATTTCAGTTTCAAATGTCCCTGCNCTGANAT
GCCTGTATGANGAACCAACCCTGAAACCNNNTGATTCNCTNNATCCTCTTTTTGCTGATTTGCNGTTCTTTCCCCTAAGG
ANTCNGTNTGCTGNGCNNAANCTTTTANANCNCTCCNGCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14919D2HMR1
Sequence
CAGTGACCNNACAGCCTTCTTTCTTCCTTAGAGGGCAATGCGAGCAAGCTGGTGAAGGTCTTCCTTCTCTTCGCCATGGT
CC
Sequence Type genomic DNA
Unitrap ID UNI23040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55027836..55027917 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es