Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12901H12
Clone ID IST12901H12
Vector VICTR76
Project tigm

Sequence tag IST12901H12BBF1
Sequence
NTTTTGGGANTANATTCTTTNNAACTTTGCCAANANCANTGGAANGNNNNANANNACCCNNNTTACAAATNNNTGGNCNA
AANCCNANTACTATTTGAATCATTCTCTCGAGGAACTACNANTAACATGCTANTAAGTATGAAAATATTTTCTGGGCTTC
TGTCANAGTTTGTTCAATTCNANANGCTGACNCTGGNAANTNNNATTTANGGACCNNCCTGGGCGACATANNATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12901H12HMF1
Sequence
GTTTTGGGAGTAGATTCTTTCTAACTTTGCCAAGAGCAGTGGAAGGACAGATAAGACCCAAGTTACAAATAAGTGA
Sequence Type genomic DNA
Unitrap ID UNI36195

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53596196..53596270 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023931 (Efhb) NM_172497 EF hand domain family, member B Gene [Source:MGI Symbol;Acc:MGI:3045296]

 
Come back to gene ENSMUSG00000023931


For any suggestions or comments, please send an email to unitrap@crg.es