Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11535D12
Clone ID IST11535D12
Vector VICTR76
Project tigm

Sequence tag IST11535D12HMR1
Sequence
GGCTNACGGGAGAGGCTTTCTTCCTCTTACCTGGTAACTTTGCCTGCCTCATCCTGTAGCCNCATTCTCTTATTTATGTC
TCCAGAATTTGGGACACCTTTAACCCTAACAATCCTACCCTCTGGCATTAATTTTCTATATAGAGTGAAACAAGATGCTT
AACTCTTTCTTAGTTTATTTGCTCTTTTACCACAACATAAGAGAAATGTATTAATCAAAAAGTCNTAATGTACTTGACTA
ATACATTCTCATACTCTGGAACAAGTTATTCTCATGGGTCTTTTGTTTGTCTGTCTGCCTANNNGCTGTTCTGANCACNA
GCNNCCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34933174..34933503 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es