Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10488E9
Clone ID IST10488E9
Vector VICTR76
Project tigm

Sequence tag IST10488E9BBF1
Sequence
TTGCCCCGAGGGGCAAGCCGACTTCCTAGAGCGCCGACTCCAGGCTGTCACACCCGCGCGGAACTGACATGGCGCCCTCT
TGGCCTGAGCTTCCGGGCGGCTCCTTCCGACGGCCCCTCGGTGATTCCGCCACTCAGCTTCCTTCCCGGCCTGCCTCGCG
CCGGCCCGCCGGGCTGGGCCAGAGCAGCCAANATGGCCGACTTTGANGATCNGGTGTCGGATGAAGAGAAGGTAAGGGGT
CCGCCTCTCTCTTTTACTTCCTTCCTCGACGGGGCCCAGGGGTCCGAGCCGGCAGCAGTGANAAACCTGGCGGTGCCCCC
ANGAAGAAGAAGGTTGTTTCCCGGTGCTGGCATANTCCCTCTGGCCCCGGGACGCTTCCTTCCTTANNNGAGCTTTCGTC
TGNCTCACGGTGGCCCCAGTCCCCCAGTCCTNNACTCTTTTCATCCTGGACAGAGCACAACCTTCTTTCANGNNGANACA
CTTTGNCTGANNGACTTTTAACTCTANACTN
Sequence Type genomic DNA
Unitrap ID UNI7213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104666979..104667486 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070372 (Capza1) NM_009797 capping protein (actin filament) muscle Z-line, alpha 1 Gene [Source:MGI (curated);Acc:Capza1-001]

 
Come back to gene ENSMUSG00000070372


For any suggestions or comments, please send an email to unitrap@crg.es