Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST446828
Clone ID OST446828
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST446828
Sequence
CTGAGCGCCAGCCCAGCATTGACCTGCTGCAGGCCTTCGTGGAACATTGGAAAGGCATCACACACTACTATATCGAGAGC
ACAGAGGNCCTGAGTTNGATTCTCAGCAACCATATGGTGTCTCAGAGNCATCNTGTANTGGGATCCGATGCTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTNTGCCCT
GGGCTCNTNCNACTGNTGNACTACCATGANNGGGNACAGNCCTGTGCAGAAACTTCTCCGACTTGGAGGGACAGNCCCTG
GATCCCTCACAGAAAAGGANGAAGTTCAGGTTCACCAGTGTCCTCTGCTCTAAGATACAGCNGGATCCAANAGCTGCTGG
CCTATATTCCTAGAGGGTAAAAAA
Sequence Type mRNA
Unitrap ID UNI14487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70989935..70993856 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022095 (Rai16) family with sequence similarity 160, member B2 Gene [Source:MGI Symbol;Acc:MGI:3036290]

 
Come back to gene ENSMUSG00000022095


For any suggestions or comments, please send an email to unitrap@crg.es