Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14789A12
Clone ID IST14789A12
Vector VICTR76
Project tigm

Sequence tag IST14789A12HMF3
Sequence
NNGNGANANCNGNGNNCNNGNNNANGNNNNNNANNCGGGGAAAGAGGACGGGTGCACAGGGACCCAGGGGCAAGGATCTC
ANAAAACCCCAGTGGTTGGTTGTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 83068401..83068470 68
NO GENE  


Sequence tag IST14789A12BBF2
Sequence
AGGGGAGACAGGCGTACCTGGGGAGGTACGGTGGGGGGAGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44056829..44056870 42
NO GENE  


Sequence tag IST14789A12HMR1
Sequence
TCCTCTTCTTGGAGAACACTGANATTGCTGCTCCTCCTCTGGCAGAGACCAAGGATCTTCCGGTTGAAGACACAGTTGAG
CCTTCTGGCCTTGCTGGCTCCTGCCAATGCTTCTTGTACCCGGGGCCTGGAGGTGGCTATGGATTCANACTCTGCTGTGT
GGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI36199

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44056664..44056829 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032105 (Pdzd3) NM_133226 PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2429554]

 
Come back to gene ENSMUSG00000032105


For any suggestions or comments, please send an email to unitrap@crg.es