Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST446780
Clone ID OST446780
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST446780
Sequence
ACTGAGAATGTCTTGTCGTTCAAGACTCGCACACTAAATGAGAAATTGACAGCCCTTGAACGGAGAATAGAGTACATTGA
AGCGAGGGTGACAAAGGGTGAGACTCTGACCTAGAAGTGCGCCGCCGCGTTGCTGCTGGGAAGTTGCTGTACAGAACACT
GCCGTGTGGGAAAGGCCCAGCAGCCTCCTGCTCCTCCTCTCTCCTTACAGAGCAACAGGGCTTTTTCTTGTTTTTCTTTT
TTCAAAAGTGGCCTTTGGGCTCTGCTGTGTGCCCTGGGGTATGACGTGGCATGGGGGAGCAAGCAGTCCAGGGGACCTCT
TGGAAACAGCATTAGGCTTTTTCCCTTTTCAGTAACATTGTTCGGAACTACTTGTCAATGTGTTTGAGGTGTTGAGAGGC
AAAGGCTGGGACTCTAAGGTCCTCCCCACCTCTCAAACTCTTTCTCTCAGACTTTCCCTACAGCTCCCATGGCCTCTACA
CTGATTTCTGTCAACAGTCGGCCTTCTCTCCACCTGTGAGAGGTGGAGGCAGTC
Sequence Type mRNA
Unitrap ID UNI3043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113565772..113566505 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033940 (6720456B07Rik) NM_133937 RIKEN cDNA 6720456B07 gene Gene [Source:MGI Symbol;Acc:MGI:1915406]

 
Come back to gene ENSMUSG00000033940


For any suggestions or comments, please send an email to unitrap@crg.es