Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14608A6
Clone ID IST14608A6
Vector VICTR74
Project tigm

Sequence tag IST14608A6HMR1
Sequence
GGACCGCTCCGCGCCGACGACCCCGGCCGCGGCTCGCTCACCAACCGCCGTGGCTTCCCAGGAGCGGGAACCCGAGAGTG
GGAGAACTTGATGCGGGTGCGGCGCGGCGCGGGACGCACAGGGCTGCGCGACTCCGCCTGGGACGATCCCAGTGCCTTCT
GTAACGGGCGGGTTGCTGTANGAAAAAACNNACCCGGCNNGCCTTTCTTTANCANNTTC
Sequence Type genomic DNA
Unitrap ID UNI26048

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 33777126..33777339 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004768 (Rab23) NM_008999 RAB23, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab23-001]

 
Come back to gene ENSMUSG00000004768


For any suggestions or comments, please send an email to unitrap@crg.es