Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13005B10
Clone ID IST13005B10
Vector VICTR76
Project tigm

Sequence tag IST13005B10HMF2
Sequence
AGAGAATGTGCATGTGTGTGTGCCACAATGAAATTGTGCAAATCTGAGGACAACTTGTTGGAGTCAGTTCAGTCCTTTTA
TCTTTATCATGTGGCCTGTGGGAATCAAACTCAGGTAGCAAGGCTTANCAGCAAGCTACTTTACCCTCTGAGCAGGTCCA
NAATCTTTAATCTTTTTNAACTGGAGGGCAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26062020..26062213 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]


Sequence tag IST13005B10BBF1
Sequence
GGACTACTTANTGAGTTCTGAGCNAGCTTGGGCTCAAGAATGAAAGCCCCATATTTCGTCTTGCCTTGGTAGGAGTTTAT
CTGTGTTAGTGTTTGGATATAAGTCTGTGGCTTCTATCCCCCTGGTTCATGTTTTGAACGTGGTCCCCTGTGAGTAATAC
TACTTTTAAAAAATGATGGAATCTTTAANAGGTGGAGGACCTAGCCTGAGGGAGTGAGTCGGAGGATGAGGTTTGGTAGC
CCGCCCCCCAGCTCACTGCCTGTCTCTACTTCCTTGACTGCCCCTGCTCTTAACCACCATCTCTTCCCNGCCNTGATGGG
CTGTACCCTTCAAACTAAAGCNNAAGTAACTTTTTTTTTTCTTTTTNGCNGATTTN
Sequence Type genomic DNA
Unitrap ID UNI19830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104794001..104794375 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035623 (Rsf1) NM_001081267 remodeling and spacing factor 1 Gene [Source:MGI (curated);Acc:Rsf1-001]

 
Come back to gene ENSMUSG00000035623


For any suggestions or comments, please send an email to unitrap@crg.es