Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14733C9
Clone ID IST14733C9
Vector VICTR76
Project tigm

Sequence tag IST14733C9HMF1
Sequence
CCAAGCCATCCTGACCCCTACATTCCTGTCTACCTTGCTGTACACTGAGATAGGGCTAAGGAATAAGAGACCTAAAGCTT
AGCATCTGAGTACATGGTTTTGGTTCCAACATTCAAAAATCTGAGGCAGGAGGATTGCCAGGAGTTGGAGGCCAGCTGGG
GCTATATAACAAGACCTTCTATCAAAAACAACAACAACAAAATTAGTTGATTATGGTGGCATGTACACTTAGGAGGTAGA
AGCAGGGGGGTCAGAAATTTAAAGTTATCCTCAGTAATATAGTAAGTTCAAGACCAGAGTAAGTTACATGGTTCACTGTC
TCAAACATACAAAGAAGCTGGGCAGTGCCNGCACATGTCTTTAATCCCAGCACTTGGGAGGCAGANGCAGGCGGATTTCC
GAGTTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI35001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71264396..71264804 405
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031392 (Irak1) NM_008363 interleukin-1 receptor-associated kinase 1 Gene [Source:MGI (curated);Acc:Irak1-004]


Sequence tag IST14733C9BBF1
Sequence
TTCCAAGCCATCCTGACCCCTACATTCCTGTCTACCTTGCTGTACACTGAGATAGGGCTAAGGAATAAGAGACCTAAAGC
TTAGCATCTGAGTACATGGTTTTGGTTCCAACATTCAAAAATCTGAGGCAGGAGGATTGCCAGGAGTTGGAGGCCANCTG
GGGCTATNTAACAAGACCTTCTATCAAAAACNACANCNNCN
Sequence Type genomic DNA
Unitrap ID UNI35001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71264612..71264805 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031392 (Irak1) NM_008363 interleukin-1 receptor-associated kinase 1 Gene [Source:MGI (curated);Acc:Irak1-004]

 
Come back to gene ENSMUSG00000031392


For any suggestions or comments, please send an email to unitrap@crg.es