Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12372C8
Clone ID IST12372C8
Vector VICTR76
Project tigm

Sequence tag IST12372C8BBF1
Sequence
CCACTATAAATACTCTCTGAGCCTGGTGGTCTAGGATGCTTGGGTCTAGATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI33315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26316628..26316684 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026923 (Notch1) NM_008714 Notch gene homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Notch1-001]

 
Come back to gene ENSMUSG00000026923


For any suggestions or comments, please send an email to unitrap@crg.es