Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11872E8
Clone ID IST11872E8
Vector VICTR76
Project tigm

Sequence tag IST11872E8BBF1
Sequence
TTTTCACTTACTGTGGATATTTATGTTTTCTCTTGTGATTATTCTCTTTATGAATTCTGTTTAAAAGCTACTGTNCCTGC
TGCTGANAAAGTCCTCACTGATATGTAGGAAGCTAATGGAANACCCACACTAGTAATAAATTAATATANCATAACTTGAA
AAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62916718..62916883 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056199 (AC130827.3)  

 
Come back to gene ENSMUSG00000056199


For any suggestions or comments, please send an email to unitrap@crg.es