Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST446572
Clone ID OST446572
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST446572
Sequence
GACTGAGGGAAAATTTCCCTTTATGAAGCAGATTTAAACAATCAACTTGNTCAGGCCGGNTCTCCATTGCCTGTCTCATC
GGACTCATCACCACTATATGCTGTGCCTTAGGCTTAGATCCGGCTGGAAAACACCACATGACTTTTCATTGGCAGATGTG
CTACCTGAACACCTGAACAGTTCCTACCAGAACCTCTGCTGTGAGCAATCCGAAAGCTGGCCAATCTCCTCCAGGCTGGC
CAGGATCCAGCCCTTAGAGTAACTCANGAGTTCCACCTGCTGTGTTATCTGGACTCCCACTAAGTGCAGCACTGTGCCTT
CGGAGCAGCACCAACAAGAATGTATCCCTTCATCCCTCCAGCTAGACTACTACCAGGATCTCCAGCACCCTTTCTTCCTT
CTGGACCATCGTGTCCCCAACCCAGTGGTCCATATCCAGGCCCTGCTGTACGAGTCCCTGGCCCCACAAGGTCATATGTT
TCAACAAATGTGCCCTTTCCAGAGCTACCTAGGCCAAATAGCGCACCCNCAGATCCAGTTGGAGGAT
Sequence Type mRNA
Unitrap ID UNI17257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 146028180..146028715 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041775 (Mapk1ip1) NM_027115 mitogen-activated protein kinase 1 interacting protein 1 Gene [Source:MGI (curated);Acc:Mapk1ip1-001]

 
Come back to gene ENSMUSG00000041775


For any suggestions or comments, please send an email to unitrap@crg.es