Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11399G1
Clone ID IST11399G1
Vector VICTR76
Project tigm

Sequence tag IST11399G1BBF1
Sequence
CCTTCCCCATGGCCNTTCACTTGCCTTAAAGGTCCCTGAGTCCCANGATTGCAGTACTTGTGCCTGCATTTTGGGGAGGA
AAGCAAAGGGCACACAGTTACATTCTGTTTTCGGCAGTCTGACTCCACACAGGGGAAGAAGCCCTATGTATTTATCCCAC
AGATCTG
Sequence Type genomic DNA
Unitrap ID UNI33315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26316839..26317004 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026923 (Notch1) NM_008714 Notch gene homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Notch1-001]

 
Come back to gene ENSMUSG00000026923


For any suggestions or comments, please send an email to unitrap@crg.es