Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13290H1
Clone ID IST13290H1
Vector VICTR74
Project tigm

Sequence tag IST13290H1HMF1
Sequence
AAGGAGTGTACTACCTTGACTAGGTCTAAACTTTTCATGGCCACTATGCCTCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26793506..26793564 59
NO GENE  


Sequence tag IST13290H1BBF1
Sequence
TTGGATTTCCAGAAAAATCCTATTAGGAATGGAGGGGCTCTTTCCCCAACATGGGTGTCATTCATACCTTAACTTGTGGC
ACACATTTTTGTCTTTTAAAGACTTCCGCATTTCTATGTTCAAAATGGCCAAAATATGTCCCTACTGCTGCCAAGACACA
CAGGTGACTCAAGGTCANAATCTGGCCCANAGGCCAGCCATTGTTCTGTGCACATTCCGGTTCTAAATCAATGTCCANTC
CTGCTTGAATTGGGTCAAGGTATGGCAGGCAANATGACCATTGTCCTCTGCCCTGAAATGATTTGAGGCTGTANATTAAA
TGTCNCACTTTCTCTGTNNNCTATTGNATTCTCNTN
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20439997..20440349 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es