Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14790E6
Clone ID IST14790E6
Vector VICTR76
Project tigm

Sequence tag IST14790E6HMF1
Sequence
ATCCAACTGTAAGGCGTTTTCTCAATTAGTGATCAAGGGGGAAAGGCACCTTGTGGATGGGACCATCTCTGGGCTGGTAG
TCTTGGTTCTATAAGAGAGCAGGCTGAGCAAGCCAGAGGAGGCAAGCCAGTAACGAATATCCCTCCATGGCCTCTGCATC
AGCTCCTGCTTCCTGACCTGCTTGAGTTCCAGTCCTGACTTCCTTGGTGATGAACAGCAGTGTGGAAGTGTAAGCCGAAT
AAACCCTTTCCTCCCCAACTTGCTTCTTGGTCATGATGTTTGTGCAGGAATAGAAACCCTGACTAAGAGACACAGTCTGT
AGAGCTTTTGTTTTGTTATTTTTGANACAATGTAGCCCCTATGGCTTGATACTTGCTGTAGTGGCTATTCCTGGTTGTCA
ACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108556234..108556635 400
NO GENE  


Sequence tag IST14790E6HMR1
Sequence
GGATCTCATGGAGGCATTTCCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI33950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 31244066..31244133 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69831919..69831986 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14432589..14432656 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056296 (Synpr) NM_028052 synaptoporin Gene [Source:MGI (curated);Acc:Synpr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150234835..150234902 68
NO GENE  

 
Come back to gene ENSMUSG00000056296


For any suggestions or comments, please send an email to unitrap@crg.es