Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14375C3
Clone ID IST14375C3
Vector VICTR74
Project tigm

Sequence tag IST14375C3HMF1
Sequence
AAACCTAGAATTGAAAAACATTTAAATAGCTCCGGTTGTCATAGCTGTTCGTTCAGCTAGACGTTTCGAAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149362896..149362966 71
NO GENE  


Sequence tag IST14375C3BBF1
Sequence
NAACCNANAATTGAAAAACATTTANNTAGCTCCGGTTGTCATANCTGTTCNTTCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14375C3HMR1
Sequence
TTTATGGCGTAAAGCGTCCTTTTTAAAATATAGATATTCCAAGGTTTCTTGGTACCAAGTAATTAACAGTTTTGCATTTT
AGGTTTTTGTTTGTCTATTGTTTGTTTTAAGCCAGTTAAGCATGTTTATTGAGCCTGGATCACTGGGCGTTGAGAACTGG
AAACAAAAACTGCTATTGTTTATTGAGGCTTTTTCCTTTGGTTTCTAAATGTTAGGGTTGCGAGTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI3005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149362669..149362898 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es