Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14775H9
Clone ID IST14775H9
Vector VICTR76
Project tigm

Sequence tag IST14775H9BBF1
Sequence
TAACCAACTGGCTTTTGGTATGCTCACAGAGTTCTGACTGGCCTTCACAATCTTGTTTATAACATCTGGAAGAAACTAAT
GCACATCAGAAGTCCCTTTTCTTCTATCCCCCCTCCCCAAGTCCCAGGCAACCACTGATCTGCTATCTGCCCATGTCTTT
AGTTTCTTTTCCCATCACACAATATTTTCAAAGTTCTTAACTGTCGTACCATGTATCAGGACCTCACTCCCTGTTGTGAT
AAAACATATTTTGTTGTATGCCCACACCACATTCTACCCACCTGTCTGTCATTAATTGATGGTCTTTCCCACTTTGAGGT
TATTATTTATAAAGCTGATCTAGCTTGGAATTGGTGAGTCAAGTGTAACTGTGTTGCTGGCTCATANTAATGATGTTAAG
TTAGACATTCNACAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 89298928..89299343 412
NO GENE  


Sequence tag IST14775H9HMR1
Sequence
GTGCCAGGTTCTGTGCAGTAATAGGGCCCCTGCTGTTTCTGGTTGCACAGGCANGCTGAGGCTTCCCTTCCTTTTTTGTC
TCAGTTTACCCTGTAGGAAGCAGCCTTGCCCCTTTTTCACAGANAACTANATGAAATATTAAAACGGCCTCCTCTTTGGA
ATGAAGAGCCAAGGCCTAAAACAAACATCACTAGGTATATGGCCN
Sequence Type genomic DNA
Unitrap ID UNI22236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80877288..80877491 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055053 (Nfic) NM_008688 nuclear factor I/C Gene [Source:MGI (curated);Acc:Nfic-004]

 
Come back to gene ENSMUSG00000055053


For any suggestions or comments, please send an email to unitrap@crg.es