Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14999B1
Clone ID IST14999B1
Vector VICTR78
Project tigm

Sequence tag IST14999B1HMF1
Sequence
CAAGAAGTGTGGTCCATTTATACAATGAAGTATCACTCAGCTGTTTAAAACAAACAAAAACCGACATCATGAATTTACAG
CCAAGTGAATGCAACTTAAAGAAACAAACAAAATACTTTGGAATCAGCTTTCCTGTTAGGAGTTTTCTTTAGATTGTTTT
GAATTTATGGTGCAAATTAAACCTACCCAACATCCCTTTTATTTTTTTAAAACCTCCCTATAATGGTGTTTTTTTACAGT
TGTAAGTATGTGAAACTGAAAATGACGTGAAATAATGTACAAAGCTATAGAAAGAGGACTTTANCATANACTTTANGGAC
NCAGAGTACATTGTTANGGTTACATANAATGATATCTNACTNANTANAANNNAATTGANAAAACNNNAANANTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121811962..121812344 354
NO GENE  


Sequence tag IST14999B1BBF1
Sequence
CAAGAAGTGTGGTCCATTTATACAATGAAGTATCACTCAGCTGTTTAAAACAAACAAAAACCGACATCATGAATTTACAG
CCAAGTGAATGCAACTTAAAGAAACAAACAAAATACTTTGGAATCAGCTTTCCTGTTAGGAGTTTTCTTTAGATTGTTTT
GAATTTATGGTGCAAATTAAACCTACCCAACATCCCTTTTATTTTTTTAAAACCTCCCTATAATGGTGTTTTTTTACAGT
TGTAAGTATGTGAAACTGAAAATGACGTGAAATAATGTACAAAGCTATANAAAGAGGACTTTANCNTAAACTTTNNGGAC
ACANAGTACATTGTNANGGTTACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121811962..121812304 325
NO GENE  


Sequence tag IST14999B1HMR1
Sequence
CTTGTTTATCCNTTCTACAGTTGAGGTACCTCTTGGTTGTTTCCAGTTTCTGGCTAGGATGAATAAATATGCTATGAACC
TAGTTGAGCAAATGTCCCTGAGGTAGGGAGGAGCACCTTTTGGATAGATTCCCAAGAGCAGTATAGCTGAGTTTTGGGTA
GATGGATTCTCAGTGTTCTGAGGAACCACAATTCTGAGGAAATACTGATTTCTATAGTGATGGTATTAGTTTGTACCCCA
CAAGGAGCTGGGGGTTTGTTNCCCTTTCTCCACATTCTTGCCNNCNNGANCTGTCNCTTGTNTTANTGANCTN
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121811654..121811965 290
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es