Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10843D10
Clone ID IST10843D10
Vector VICTR76
Project tigm

Sequence tag IST10843D10HMR1
Sequence
AAGACTTTCTAACTTCAACATGCACAACTGTTTTACCCATCTGAGAGTCAAAACTTTAATTACTTTGAGTTTCCTGCTGC
TACAGTGATGATTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI1043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76875928..76876028 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]


Sequence tag IST10843D10HMF1
Sequence
TTCTTAACTGAAAATAATGAGATCTATAACTCAAAAACTCTCTCACACACCCCAAGGGTGTTTGGGATATGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76876025..76876095 71
NO GENE  

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es