Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST446152
Clone ID OST446152
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST446152
Sequence
TTGTGGTGTCTGAGACAAGCACTACGCAGCTCACTTTGCTGACCCTGACACCTTAGTCAACTGGGACTTTGTGGAACAAG
TGCGCATCTGTAGCCATGAAGTGCCATCTTGCCCAATATGCCTCTATCCACCTACTGCGGCCAAGATAACGCGCTGTGGA
CACATTTTCTGCTGGGCATGCATCCTGCACTATCTTTCACTCAGTGAGAAAACCTGGAGCAAATGTCCCATCTGCTACAG
CTCTGTGCATAAGAAGGATCTCAAGAGTGTTGTTGCCACAGAGTCTCGACAGTATGCTGTGGGGGACACCATTACCATGC
AGCTGATGAAGAGAGAGAAGGGAGTGTTGGTGGCCCTGCCCAAATCCAAGTGGGTGAATGTAGACCATCCTATTAACCTA
GGAGATGANCAGCTTCANCCAGTATTCCAAGCTGCTGCTGGCCTNNAAGGAGCAGGTGCTGCACCG
Sequence Type mRNA
Unitrap ID UNI4709

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115700079..115705441 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041740 (Rnf10) NM_016698 ring finger protein 10 Gene [Source:MGI (curated);Acc:Rnf10-002]

 
Come back to gene ENSMUSG00000041740


For any suggestions or comments, please send an email to unitrap@crg.es