Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14312D6
Clone ID IST14312D6
Vector VICTR74
Project tigm

Sequence tag IST14312D6HMR1
Sequence
NNGAAACTTATCNNAAAANAAAAACAAGCCAAACGTTTTTGTTCNNNAGCTGGGTTCTGAANACNGGANTCCNGCTGCCN
TGTGTAACTACAGCCCNNNGGGGTCCCTGATAAGGGGAGGGANTANCCTTTTANCATCGGCGGGAGCCTGTGACACTCAC
TGACCATCCCTGGTCTCTGCATTGCTCTAAAAGGTTTACAGACACACANCCCTGANAAGTCCTATGCAAAGGTTCTGGGG
CANCTTTGTGGGAGGTGANGGACCTCACCGGTTCTTTTGTTNANGANTNCNTCNCCGGGGCACACNGATGCTCAGGGGGA
NCNCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14312D6HMF1
Sequence
ACCCTCCCCTCCCTAACNAGCTTTTTGGTCATGGTGCTTCGTCNCANCAATGGAAACCCTAANACAATGTTGGTTTTGTT
TCTGTATGAGCAGGACTCTGTGTGAGCCTCCTTTANGGTGTTTCTTTTCTAAAGCTGCATTTACAAACCCTTTAAGTGTC
TCTACCATGACCCANANAAGCAAATGCANCGCTGTTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30924842..30925042 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es