Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11451G12
Clone ID IST11451G12
Vector VICTR76
Project tigm

Sequence tag IST11451G12HMF2
Sequence
CTTTCTTCTTCTCATTTCTTTGTGCACAACTACTTGACAAACTGTGATCAACTGCAACCAACATTATCCAAGGACCGACC
AGCCACACACCTCTTGAGGCCCTAGTATTTTTATCTTCTCTGAAAACTTGCCAGAATTCCAAGTATTACACACTCACAGA
AACTATTTCCAGCTGCCAAAATCACACCCCTGCTAAAGCATGAANCAAATCCTANCCACCTGCTGTGAAGCACTCCCATA
TCNCTGCACCTGGAATTAAAATANANCCNTATTCCCATAACATTTCTGTGTATTTTCAAAGAAACCAAANTTACACACCT
CACACTANACTCAAGCCATGCCTANTGTCTCTGTTCTTGCTACCTGCTGATCTGGACTGAGACCTGTCACANCATGTCTG
CCCATGTGCAACCATACTCCCCACAGTGGCGATGATGGACTAACCCTCTGANATGGTAAGCAATTGCTCCTTTACAAGAN
TTCCTGTGGCCTGTAANGNNCTTGCNTGTGCACTATANAANCNTCNNCTGCCAATAAAAAANCTGANTNNANNGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11451G12BBF1
Sequence
TCCCCTCATGGAGACTCCCTTTACTCCTTGTCCTTTCTTCTTCCACTCCTCTCTGCCTAAGACCTTCAGTCAGGTAACTG
AAAACCTGCCTACCTCTCTGTATTGACCAATTACCGGGTTTAGCTTTTATTGNCCANTTAACTTGGAGAGCAAGGTTCAC
CCAACAAAAGTTGGTATACATGANAATCCTCTTGTCTTGGAGCANCCNNACCTTGGAGTACAGAATTTAGCATTTGATTA
CNAACAGCATCANACCAATCCCGTACACCGGATTCTTAATCAAGATAGAAACAGAAAAAGAGAAGTGCTTATTAAGCAAG
CGTGAGCATCTGAGTTCCTTACCAACACCCACATAAAATGTCGGTCATGGTGTCNTGTACCTGTGATCTCANGGCTGANG
ATCT
Sequence Type genomic DNA
Unitrap ID UNI14180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30857713..30858115 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047412 (CT025653.7-201) NM_172765 Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0A2]

 
Come back to gene ENSMUSG00000047412


For any suggestions or comments, please send an email to unitrap@crg.es