Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12866H1
Clone ID IST12866H1
Vector VICTR76
Project tigm

Sequence tag IST12866H1HMF1
Sequence
GTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCGAAGTTCAAATCCCAGCAACCACATGGTGGC
TCACAACCATCTGTAATGAGATCTGATGCCCTCTTCTGGTGCATCTGAANACAGCTACAGTGTACTTACATATAATAAAT
AAATAAATAAATCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 167449825..167450029 199
 
EST/CDNA Est Name
  CF909299.1 - AI035965.1 - CJ169077.1 - BF151072.1 - CJ078220.1 - AW012666.1 - AW227730.1 - AA104574.1 - AA492949.1


Sequence tag IST12866H1BBF1
Sequence
GTGAGATGGCTCAGTGGGTAANAGCACCCGACTGCTCTTCCGAAGGTCCGAAGTTCAAATCCCAGCAACCACATGGTGGC
TCACAACCATCTGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI2538 UNI17846 UNI27437 UNI36221 UNI36222

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 136834028..136834132 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 114722854..114722958 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19977667..19977771 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 74257904..74258008 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49541131..49541235 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102559357..102559461 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 82809907..82810011 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71159755..71159859 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 42600201..42600305 103
 
EST/CDNA Est Name
  AV070692.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10876760..10876864 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121418737..121418841 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 37367765..37367869 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027722 (Spata5) NM_021343 spermatogenesis associated 5 Gene [Source:MGI (curated);Acc:Spata5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5925055..5925159 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121984950..121985054 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029454 (Mapkapk5) NM_010765 MAP kinase-activated protein kinase 5 Gene [Source:MGI (curated);Acc:Mapkapk5-005]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 140593538..140593642 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 63514963..63515067 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030450 (Oca2) NM_021879 oculocutaneous albinism II Gene [Source:MGI Symbol;Acc:MGI:97454]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 95627325..95627429 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057400 (Es1) NM_007954 esterase 1 Gene [Source:MGI (curated);Acc:Es1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114900692..114900796 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 92798370..92798474 103
NO GENE  

 
Come back to gene ENSMUSG00000057400


For any suggestions or comments, please send an email to unitrap@crg.es