Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST446103
Clone ID OST446103
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST446103
Sequence
TGAGGCCTGTCTCCAGACTTGCAATCCATGGGAGCAGATTAGGCGTATTATGCGGCCCACAGACGTGCCTGACCAGGGCC
TACTGTGTGATCTCCTGTGGTCTGACCCTGACAAGGATGTTCAAGGCTGGGGCGAGAATGACCGTGGTGTCTCCTTTACC
TTTGGGGCTGAGGTGGTAGCCAAGTTCCTGCACAAGCATGATTTGGACCTCATCTGCAGAGCACATCAGGTTGTAGAAGA
TGGCTATGAGTTCTTTGCCAAGAGACAGTTGGTGACACTCTTCTCAGCTCCCAACTACTGTGGAGAGTTTGACAATGCTG
GTGCCATGATGAGTGTGGATGAGACCCTCATGTGTTCCTTCCAGATCCTCAAGCCCGCTGATAAGAATAAGGGCAAGTAT
GGGCAGTTCAGCGGCCTGAACCCCGGAGGCCGGCCCATCACTCCACCCCGCAATTCTGCCAAAGCCAAGAAATAGCCTCC
ATGTGCTGCCCTTCTT
Sequence Type mRNA
Unitrap ID UNI17274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4194465..4195112 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040385 (Ppp1ca) NM_031868 protein phosphatase 1, catalytic subunit, alpha isoform Gene [Source:MGI Symbol;Acc:MGI:103016]

 
Come back to gene ENSMUSG00000040385


For any suggestions or comments, please send an email to unitrap@crg.es