Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14988B9
Clone ID IST14988B9
Vector VICTR80
Project tigm

Sequence tag IST14988B9BBF1
Sequence
GAGACTAGATTTTGCTCATGTCCATACTTCCGGAGGACTACTCCTGGGCCTGGTACAGTGAGTGCTGGTTAATCGTAGAT
TACAAACCCAATTCAAACCACCCAAAGGACAAGTGTCCAAGGCAGTATCCCTTCAAGGTCATTTAGGATATCACAGAATT
AGATTCAGATGACTTAATCACTACACAACTTGGGGCTAGGAAGATAGCTCTGAAGGTAGGGACAAGGGATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103796012..103796242 231
 
EST/CDNA Est Name
  BY124081.1 - BY317832.1 - BY127453.1 - BY126612.1 - BY125280.1 - BY098240.1 - BY109168.1 - CJ087929.1 - BY778167.1 - BY125406.1 - BY048316.1 - BY127208.1 - BY128893.1 - BY294269.1 - BY326858.1 - BY129364.1 - BY124848.1 - BY331188.1 - BY128850.1 - BY130696


Sequence tag IST14988B9HMR1
Sequence
GTCTCCAACCTTAANAATTATCCTAGGTATGATTCAAGTGTGTAGGCAGACAGTGAAGGTCATCTTCAGGGCTTCCATGC
ATGTCTTCTCAGTTCTGTGGGGAGGGGCAGCTGTCCAGAATGTCTCCTAGAATAAGTATTGTCTAAGCTGANAACTGTAG
AGTGTATAAGAATT
Sequence Type genomic DNA
Unitrap ID UNI32838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103795843..103796016 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]


Sequence tag IST14988B9HMF1
Sequence
NANACTAGATTTTGCTCATGTCCATACTTCCGGAGGACTACTCCTGGGCCTGGTACAGTGAGTGCTGGTTAATCGTAGAT
TACAAACCCAATTCAAACCACCCAAAGGACAAGTGTCCAAGGCAGTATCCCTTCAAGGTCATTTAGGATATCACAGAATT
AGATTCAGATGACTTAATCACTACACAACTTGGGGCTAGGAAGATAGCTCTGAAGGTAGGGACAAGGGATCCACACAGCA
AACTGGATGAGGAACCTANCCATGTATGGGAGCTCTGAGTTTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103796015..103796297 281
 
EST/CDNA Est Name
  CJ076153.1 - BY289755.1 - BY270706.1 - BY238163.1 - BY292187.1 - BY032189.1 - BY237693.1 - BY283218.1 - BY288670.1 - BY295746.1 - BY273221.1 - BY239246.1 - BY077052.1 - BY284695.1 - BY032190.1 - BY261703.1 - BY284260.1 - BY295206.1 - BY295806.1 - BY292158

 
Come back to gene CJ076153.1 - BY289755.1 - BY270706.1 - BY238163.1 - BY292187.1 - BY032189.1 - BY237693.1 - BY283218.1 - BY288670.1 - BY295746.1 - BY273221.1 - BY239246.1 - BY077052.1 - BY284695.1 - BY032190.1 - BY261703.1 - BY284260.1 - BY295206.1 - BY295806.1 - BY292158


For any suggestions or comments, please send an email to unitrap@crg.es