Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14168G10
Clone ID IST14168G10
Vector VICTR74
Project tigm

Sequence tag IST14168G10HMR1
Sequence
GATGAGTGTAAAGAGGTGCACNANTAAGCAGGGGAATGGGATTGGGCCTTAACANATTTTGAGAGATTTGCCTTGCAACT
GACCAAAATGCTAGTATGGGTGAGATATGGCTGCTGTTACGTGATTTGGGGCGAGTTTTANACGGAATTAATAATGATAG
TGTAGCTTGAGGCTAGGGGAGAAGGTAGGAGTCCGCGTTC
Sequence Type genomic DNA
Unitrap ID UNI13516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104620011..104620209 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es