Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14276E9
Clone ID IST14276E9
Vector VICTR74
Project tigm

Sequence tag IST14276E9BBF1
Sequence
GAAAAACCAAAACAAGCAAAAAAACAAAAAACAAAAATCCAATGTGCCTTCATGATCAAAATTCGATAGTCAATAGTACT
AGAAGAATCATATGTCTGAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3006312..3006379 66
NO GENE  


Sequence tag IST14276E9HMR1
Sequence
ACAGGGTTTCTCTGTATACCCTGGCTGTCCTGGC
Sequence Type genomic DNA
Unitrap ID UNI2237 UNI36224 UNI36225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88301735..88301767 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41128489..41128521 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8985228..8985260 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021149 (Gtpbp4) NM_027000 GTP binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916487]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62273051..62273083 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 80781121..80781153 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022407 (Adsl) NM_009634 adenylosuccinate lyase Gene [Source:MGI Symbol;Acc:MGI:103202]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126773797..126773829 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042408 (Zmym6) NM_177462 zinc finger, MYM-type 6 Gene [Source:MGI (curated);Acc:Zmym6-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 148757595..148757627 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 47825904..47825936 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3267692..3267724 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59253915..59253947 33
NO GENE  

 
Come back to gene ENSMUSG00000042408


For any suggestions or comments, please send an email to unitrap@crg.es