Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14804H8
Clone ID IST14804H8
Vector VICTR76
Project tigm

Sequence tag IST14804H8HMR1
Sequence
TGTGTCTGTCTGTCTATATCTGAAACCCTTTGTTTTCCTCTGTATATTAACTATATTATGCTTCTTANAAGCATAATCTT
CCAGAAGCTTGGAAATACCCTTGACGTTTAAACACCTAAGAAGCAAGGGCTTGTGAACGTGGATCCTCCTGGTTATCACC
TACTCGGTGATGCAGATGGCTGCCGCAGTGTGTCCTGTCTGCTATGGATTCATAANCGTTCCANATCTCANTTC
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25691238..25691470 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


Sequence tag IST14804H8HMF1
Sequence
ATATTACACATTATAGTTAAGCTTGAACTTTGTATTAAAAGTAGTACTGCATGGGCCAGTGAGGTGTCTCAGGAGGCAAG
GGTGCTTACTGGCAAGATTGATAAACTGAGTTTACTCCTCAGGAACCATTGGTAAAAGGAAAGAGCACAGCACATCAAAT
TGTCCTTGACTTCTACATGCATTTATGTGTGCGCACACACAGACAGACAGACAGACCGAATGAGTTAATGTGGTACTAAA
AAAAATATGGTAGTATTGCATTGCCCACTTTAAAACAAATTTATTTAATTTACAGTAATCCCTGTTCTCTAGTCATGAAT
TTCTTCTGTTCTATAACTTTCTGTATAGGCCAGGCTGGCCTCAAACTCACAGAGGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI36229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27184810..27185189 380
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es