Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0262
Clone ID AD0262
Vector pGT0lxr
Project sanger

Sequence tag AD0262
Sequence
AGGTGGTCGAAATGGCTATGGAGCTAAACTGTGTAACATATTCAGCACCAAATTTACTGTGGAAACAGCCAGTAGAGAGT
ACAAGAAAATGTTCAAACAGACGTGGATGGATAACATGGGGAGAGCTGGTGACATGGAACTCAAGCCCTTTAGTGGAGAA
GATTATACATGTTTCACCTTCCAGCGTGAGTGATCTAAGTTTGAAAGGCAAAGCAGGTACAAAGATATGGTTGCTATGAG
CTGTTAGAGGAGGATGTTATGAGGTCTTCTAGATGGTGGTTGTGAGCTGTTCTAGATGGTGGTTGTGAGCTCTTCTAGAT
GGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGNCTTTCTAGATGGAACTGGGAATTCACTGAAGGTGATACATGAAC
AGGTCAATCCCCGGTGGGAAGTGTGCTTAACAATGAGCGAGAGAGGCTTCCAGCAGATTAGCTTCGTCAACAGCATTGCG
ACTTCTAAG
Sequence Type mRNA
Unitrap ID UNI3314

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98876200..98877843 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]

 
Come back to gene ENSMUSG00000020914


For any suggestions or comments, please send an email to unitrap@crg.es