Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14774B8
Clone ID IST14774B8
Vector VICTR76
Project tigm

Sequence tag IST14774B8BBF1
Sequence
CCTNNNACAACCTGANTGGAATTATAAAATGACCTAAATGCNATGGAAAANCANCTACCATACAGCTAATCCAACAACTT
CACTCTGGTTGCACAACCAAAATAACCAAAAGCCGGTTTGGAAAGGTACCTGCACATGCATGTTCATCACTGTAACAATA
GCTTANTAAACAAGCCTATTACTGATACTACATACATTAAGGCAATGGTTCTCAACCTGTGGGTCACAACCACTTCCAGG
GCTCACATAAGAGAAATTCTGCCTATCAGTTACTTACATTACGACTCCTAACAGCAGCACAACTACAGCTATGAAGTAGC
AAGGAAAGTAATTTTATGGTTGGGGATCACCACATGAGAAACTGTATTCAANGATTGCAGCATTANAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50127614..50127995 366
 
EST/CDNA Est Name
  BY668499.1 - CN680335.1 - CF898516.1 - CD539472.1 - CN682864.1 - CD546401.1 - CF165768.1 - CN672680.1 - CF165709.1 - CF906479.1 - CN684218.1 - CN686026.1 - CN687438.1 - CN683104.1 - CN669673.1 - BF179022.1 - BB568675.2 - CN691654.1 - CN680029.1 - CA870302


Sequence tag IST14774B8HMR1
Sequence
GTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCANGCTGGCTTCANAAATCCACCTGCCTCTGCCTC
CCAAGTGCTGGGATTAAAGACATGCACCACCACCGCCCGGCTTCTTGCTGTGTTTATAACAATATCATGATGAGTTTTGG
TAGAAATTGTGGGCTTATATTGCTTTGAAAAGGTGAGAAGTGTTCAAGAAAAGAAAGCAAGTAGGTGAAAGTAATANTGT
GGCN
Sequence Type genomic DNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50127267..50127509 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]


Sequence tag IST14774B8HMF2
Sequence
ATACAAAAGCTTATGAAACTTTTAATAAAAATATAATCCAGATACAATACACAATAGTAAATGTTCCCTTGTACAACCTG
AGTGGAATTATAAAATGACCTAAATGCTATGGAAAAGCAGCTACCATACAGCTAATCCAACAACTTCACTCTGGTTGCAC
AACCAAAATAACCAAAAGCCGGTTTGGAGAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50127542..50127732 191
 
EST/CDNA Est Name
  CF900660.1 - CJ074576.1 - BY146848.1 - BY007458.1 - BY127036.1 - BY302607.1 - BY269213.1

 
Come back to gene CF900660.1 - CJ074576.1 - BY146848.1 - BY007458.1 - BY127036.1 - BY302607.1 - BY269213.1


For any suggestions or comments, please send an email to unitrap@crg.es