Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11654H3
Clone ID IST11654H3
Vector VICTR76
Project tigm

Sequence tag IST11654H3BBF1
Sequence
TTTTTTTAAAGATTTATTTATTTATTATATGTAAGTACACTGTANCTGTCTTCAGACACTCCAGAAGAGGGCACCAGATC
TG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 94347262..94347342 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56546818..56546898 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155280944..155281024 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54080459..54080539 79
NO GENE  


Sequence tag IST11654H3HMR1
Sequence
AGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACANANAAACCCTGT
NNCN
Sequence Type genomic DNA
Unitrap ID UNI14153 UNI29063 UNI32421 UNI36230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7313226..7313305 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 39955136..39955215 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4633465..4633544 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4978543..4978622 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12363596..12363675 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14894269..14894348 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021738 (Atxn7) NM_139227 ataxin 7 Gene [Source:MGI Symbol;Acc:MGI:2179277]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8539308..8539387 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4533101..4533180 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4756139..4756218 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9974629..9974708 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024287 (Thoc1) NM_153552 THO complex 1 Gene [Source:MGI Symbol;Acc:MGI:1919668]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3537290..3537369 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 10226000..10226079 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 24972449..24972528 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8535388..8535467 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5927785..5927864 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29548896..29548975 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3251167..3251246 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26856722..26856801 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14098754..14098833 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032009 (Sesn3) NM_030261 sestrin 3 Gene [Source:MGI (curated);Acc:Sesn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166327: 2804..2883 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4696369..4696448 76
NO GENE  

 
Come back to gene ENSMUSG00000032009


For any suggestions or comments, please send an email to unitrap@crg.es