Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14120D10
Clone ID IST14120D10
Vector VICTR74
Project tigm

Sequence tag IST14120D10BBF1
Sequence
ATGGTGGTTCACAACCATCTGTAATGAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI14516 UNI31801 UNI36232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84935040..84935075 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020042 (Btbd11) NM_001017525 BTB (POZ) domain containing 11 Gene [Source:MGI (curated);Acc:Btbd11-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3886546..3886581 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049721 (Gal3st1) NM_016922 galactose-3-O-sulfotransferase 1 Gene [Source:MGI (curated);Acc:Gal3st1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31881350..31881385 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15798643..15798678 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42041554..42041589 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025159 (Mms19) NM_028152 MMS19 (MET18 S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919449]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51252877..51252912 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132180575..132180610 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67350615..67350650 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 148927706..148927741 34
NO GENE  

 
Come back to gene ENSMUSG00000025159


For any suggestions or comments, please send an email to unitrap@crg.es