Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12138F3
Clone ID IST12138F3
Vector VICTR76
Project tigm

Sequence tag IST12138F3HMF2
Sequence
GATATCCCACTCCAGAGGCCACATCCCACTTTCCTGGGTCAGCAGCTTGCAAGGTGGAGGGCACCGGCACCTTCCCATAA
GGCATTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 113595131..113595222 92
 
EST/CDNA Est Name
  CD555090.1


Sequence tag IST12138F3BBF1
Sequence
ATACATCCCTGCCCCCCATGGATTGTTATTGTTGTTTTGAGACCGAGTTTCTCTGTGTAGCCCTAACTGTCCTCTAACTC
ACTCTGTANACCAGGCTGGCCTGGAACTCAGAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34931082..34931198 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es