Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12948B2
Clone ID IST12948B2
Vector VICTR76
Project tigm

Sequence tag IST12948B2BBF1
Sequence
NAATCTTTTATAAAAATGGCTTTACTCTGTTGTCTGTGAGCATTCATTTTACAGGCTAAATGAAGGCAGCCATCTGTTGA
TGTACTTGCTGTCTGGAGAGTGGTATCCACATGTTCAGATTGAACTGCTTTAAGCCAGCTTTATTTATGTGTGATTCAGC
CAGTTTATGTAGTTTTTGTTTTGTTTGATATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCNATC
TN
Sequence Type genomic DNA
Unitrap ID UNI27914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 172807805..172808044 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026659 (Dusp12) NM_023173 dual specificity phosphatase 12 Gene [Source:MGI Symbol;Acc:MGI:1890614]

 
Come back to gene ENSMUSG00000026659


For any suggestions or comments, please send an email to unitrap@crg.es