Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11055C5
Clone ID IST11055C5
Vector VICTR76
Project tigm

Sequence tag IST11055C5HMF1
Sequence
CAGACTTAGATTTCAATAGAGGCAAGAGGCATGCTTAACTAAGCAGCTGAGTCATGGTGTAGTCCTGCCCCTCACCAACC
TTTCACTGGCTTTTGGTTACAGCTCTGTCTTGCTAAAGTTAGCATTGTGTGAAATCTCTCTGATAAATACATCTCTCTGC
TGGCACCAGGGTTCCTGANAAATTCCAATTCCTTGGAGTCTATTGTTTCAAAAGTCTGATAGCAGGGAAGAGGCACATGT
GCCTTTCTGTAGAGTATCTTTGCTCCTGTCTGGATGATTACACTTTGACCTCTGATAAAATTTGTTGCTCACGANAATTG
TACCTGTCTAGTTTTAAAGAACATCACTACAGTCTGTGTTTGTTTATTTAAGGTAGGAGCAAAAAGGGGGCATAAACAGG
GGTACTGCATGATTTCTGTAGTAAGTACTTGGGACTNCCTCTTGANGGTGAGTCATGTCTCCATTTTACCNACAGGGAAA
CNNAAGTCTGANAACAGANNGGATCTGGCAAAGCTGAANTTCAGCATTTTCCCACAGCCNCCTCATTTTATTAAACTGTG
CGGNCTANAGTAN
Sequence Type genomic DNA
Unitrap ID UNI36235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108847927..108848498 544
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028559 (Osbpl9) NM_133885 oxysterol binding protein-like 9 Gene [Source:MGI (curated);Acc:Osbpl9-001]

 
Come back to gene ENSMUSG00000028559


For any suggestions or comments, please send an email to unitrap@crg.es