Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14795B12
Clone ID IST14795B12
Vector VICTR76
Project tigm

Sequence tag IST14795B12BBF1
Sequence
ATCTGACTCCCTCTTTTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96481117..96481188 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 167500271..167500342 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169452214..169452285 72
NO GENE  


Sequence tag IST14795B12HMR1
Sequence
AGANCTTACTACTGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTAGGGAAGAACAGTCACTAT
TCTTAACCGCTGAGCCATCTCTCTAGCCCGGTGCATACCTTTAATCCCAGGACTTGTGAGGCAGAGGCAGGAGGATTTCC
CTGAGTTTGAGGCCNGCCTGGTCTACAGAGTGAGTTGCAGAACAGTCAGGGCTACCCANANAAACCATGTCATGAAAAAC
AAANAAAAAAAAACCAAAACAAAAAACAAAAAACAAAACAACAGCAAGCCCTAAAATGACANANGTANTAAAAAGTANTG
TTTTTCCTGANANAGTCTTANTTAATTAACCTCAAACTTGANATTTTCATCTCAGTCTCTCAAGTGTTGTATGCCTGCCA
ATACATATATATGTGTGTATATATCNGCNTCTACATGCGCACACACATGCNTGTANCGCTTCATGAATCTCAAACTGCCT
ATAANCTGGCTATGTANCTGANGCTGGNCN
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96481185..96481691 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST14795B12HMF2
Sequence
ATCTGACTCCCTCTTTTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169452214..169452285 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 167500271..167500342 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96481117..96481188 72
NO GENE  

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es