Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14279B12
Clone ID IST14279B12
Vector VICTR74
Project tigm

Sequence tag IST14279B12HMR1
Sequence
GGATGTCACTGCTGAACTGTGGCTGTAGTGACGTCTAGGTAGAGCACTGCCAGAAACACTTTGGATTCATTACACATTTG
ACTTCTGAATTGTTCTTGCTAGATTTTTCNTCACCTCACATTCAGCTACATGACCCTATATGGGGTTGTGATCCCCAACT
GGAGAAGCTCTGAGGCTACCTACAGTTCTCATGCTGTGTCAGAAGGAGCGTANTTGCGGGCTAAATGTTTCTTACCTTGT
TN
Sequence Type genomic DNA
Unitrap ID UNI10843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 34426593..34426833 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022325 (Pop1) NM_026340 processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae) Gene [Source:MGI (curated);Acc:Pop1-001]

 
Come back to gene ENSMUSG00000022325


For any suggestions or comments, please send an email to unitrap@crg.es