Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST445445
Clone ID OST445445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST445445
Sequence
ACCAGGCAGCGGGCAGGTGTTTGTGACCTCGGANAACCAGCTTGTGTACTACCCCAGCATCACGTACGCCATCATCGGCA
GCTCTGTCATCTTCGTGCTGGTGGTGGCCCTGCTCGCACTGGTCCTGCATCATCAGCGAAAGCGAAACAACCTCATGACC
CTCCCTGTGCACCGGCTGCAGCATCCTGTGCTGCTCTCTCGCCTGGTGGTCCTGGACCACCCTCACCACTGCAACGTCAC
CTACAATGTCAATAATGGTGTTCAGTATGTGGCTACCCAGGCTGAACAAAATGCCTCGGAAGTAGGCTCTCCACCCTCCT
ATTCAGAGGCCCTGCTGGACCAAAGACCTGCATGGTACGACCTTCCTCCACCACCCTATTCATCTGACACCGAGTCTCTG
AACCAAGCTGACCTGCCTCCTTACCGCTCCCGGTCAGGAAGTGCCTACAGTGCCAGCTCCCAGGCAGCCAGCAGCCTCCT
GAGTGTGGAAGCCAGCA
Sequence Type mRNA
Unitrap ID UNI1240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101793181..101795330 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es